Thu . 20 Jul 2020
TR | RU | UK | KK | BE |

Alu element

alu element, alu element chromosome 16
An Alu element is a short stretch of DNA originally characterized by the action of the Arthrobacter luteus Alu restriction endonuclease[1] Alu elements are the most abundant transposable elements, containing over one million copies dispersed throughout the human genome[2] Alu elements are also known as selfish or parasitic genes, because their sole function is self reproduction[3] They are derived from the small cytoplasmic 7SL RNA, a component of the signal recognition particle Alu elements are highly conserved within primate genomes and originated in the genome of an ancestor of Supraprimates[4]

Alu insertions have been implicated in several inherited human diseases and in various forms of cancer[citation needed]

The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans[citation needed]

Karyotype from a female human lymphocyte 46, XX Chromosomes were hybridized with a probe for Alu elements green and counterstained with TOPRO-3 red Alu elements were used as a marker for chromosomes and chromosome bands rich in genes

Contents

  • 1 The Alu family
  • 2 7SL RNA
  • 3 Alu elements
  • 4 Impact of Alu in humans
    • 41 Associations with human disease
    • 42 Other Alu-associated human mutations
  • 5 References
  • 6 External links

The Alu family

The Alu family is a family of repetitive elements in the human genome Modern Alu elements are about 300 base pairs long and are therefore classified as short interspersed nuclear elements SINEs among the class of repetitive DNA elements The typical structure is 5' - Part A - A5TACA6 - Part B - PolyA Tail - 3', where Part A and Part B are similar nucleotide sequences Expressed another way, it is believed modern Alu elements emerged from a head to tail fusion of two distinct FAMs fossil antique monomers over 100 mya, hence its dimeric structure of two similar, but distinct monomers left and right arms joined by an A-rich linker[5] The length of the polyA tail varies between Alu families

There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 107% of the human genome consists of Alu sequences However, less than 05% are polymorphic ie they occur in more than one form or morph[6] In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ named after Jurka and AluS named after Smith, and other Alu subfamilies were also independently discovered by several groups[7] Later on, a sub-subfamily of AluS which included active Alu elements was given the separate name AluY Dating back 65 million years, the AluJ lineage is the oldest and least active in the human genome The younger AluS lineage is about 30 million years old and still contains some active elements Finally, the AluY elements are the youngest of the three and have the greatest disposition to move along the human genome[8] The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements active elements and interspersed repetitive DNA mutated copies of active elements[9]

7SL RNA

The functional retinoic acid response element hexamer sites[10] are in upper case and overlap the internal transcriptional promoter An example of a human Alu monomer, 153 basepairs long, derived from 7SL RNA: GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCagctACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGT TCTGGGCTGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC

The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues in lowercase above [11]

Alu elements

Alu elements are responsible for regulation of tissue-specific genes They are also involved in the transcription of nearby genes and can sometimes change the way a gene is expressed[12]

Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs Alu elements do not encode for protein products They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements[13]

Alu elements replication and mobilization begins by interactions with signal recognition particles SRPs, which aid newly translated proteins reach final destinations[14] Alu RNA forms a specific RNA:protein complex with a protein heterodimer consisting of SRP9 and SRP14[14] SRP9/14 facilitates Alu's attachment to ribosomes that capture nascent L1 proteins Thus, an Alu element can take control of the L1 protein's reverse transcriptase, ensuring that the Alu's RNA sequence gets copied into the genome rather than the L1's mRNA[8]

Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation The study of Alu Y elements the more recently evolved thus reveals details of ancestry because individuals will only share a particular Alu element insertion if they have a common ancestor[citation needed]This is because insertion of an Alu element occurs only 100 - 200 times per million years, and no known mechanism of deletion of one has been found Therefore, individuals with an element likely descended from an ancestor with one—and vice versa, for those without In genetics, presence or lack thereof of a recently inserted Alu element may be a good property to consider when studying human evolution[15]

Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans[16]

Impact of Alu in humans

Alu elements have been proposed to affect gene expression and been found to contain functional promoter regions for steroid hormone receptors[10][17] Due to the abundant content of CpG dinucleotides found in Alu elements, these regions serve as a site of methylation, contributing to up to 30% of the methylation sites in the human genome[18] Alu elements are also a common source of mutations in humans, however, such mutations are often confined to non-coding regions of pre-mRNA introns, where they have little discernible impact on the bearer[19] Mutations in the introns or non-coding regions of RNA have little or no effect on phenotype of an individual if the coding portion of individual's genome does not contain mutations The Alu insertions that can be detrimental to the human body are inserted into coding regions exons or into mRNA after the process of splicing[20]

However, the variation generated can be used in studies of the movement and ancestry of human populations,[21] and the mutagenic effect of Alu[22] and retrotransposons in general[23] has played a major role in the recent evolution of the human genome[citation needed] There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans:

Associations with human disease

Alu insertions are sometimes disruptive and can result in inherited disorders However, most Alu variation acts as markers that segregate with the disease so the presence of a particular Alu allele does not mean that the carrier will definitely get the disease The first report of Alu-mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer[24] In the human genome, the most recently active have been the 22 AluY and 6 AluS Transposon Element subfamilies due to their inherited activity to cause various cancers Thus due to their major heritable damage it is important to understand the causes that affect their transpositional activity[25]

The following human diseases have been linked with Alu insertions:[21][26]

  • Alport syndrome
  • Breast cancer
  • chorioretinal degeneration
  • Ewing's sarcoma
  • Familial hypercholesterolemia
  • Hemophilia
  • Leigh syndrome
  • mucopolysaccharidosis VII
  • Neurofibromatosis
  • Diabetes mellitus type II

And the following diseases have been associated with single-nucleotide DNA variations in Alu elements affecting transcription levels:[27]

  • Alzheimer's disease
  • Lung cancer
  • Gastric cancer

Other Alu-associated human mutations

  • The ACE gene, encoding angiotensin-converting enzyme, has 2 common variants, one with an Alu insertion ACE-I and one with the Alu deleted ACE-D This variation has been linked to changes in sporting ability: the presence of the Alu element is associated with better performance in endurance-oriented events eg triathlons, whereas its absence is associated with strength- and power-oriented performance[28]
  • The opsin gene duplication which resulted in the re-gaining of trichromacy in Old World primates including humans is flanked by an Alu element,[29] implicating the role of Alu in the evolution of three colour vision[citation needed]

References

  1. ^ Schmid, Carl W; Deininger, Prescott L 1975 "Sequence organization of the human genome" Cell 6 3: 345–58 doi:101016/0092-86747590184-1 PMID 1052772 
  2. ^ Szmulewicz, Martin N; Novick, Gabriel E; Herrera, Rene J 1998 "Effects of Alu insertions on gene function" Electrophoresis 19 8–9: 1260–4 doi:101002/elps1150190806 PMID 9694261 
  3. ^ Kidwell, Margaret G; Lisch, Damon R 2001 "Perspective: Transposable Elements, Parasitic Dna, and Genome Evolution" Evolution 55 1: 1–24 doi:101554/0014-38202001055[0001:ptepda]20co;2 PMID 11263730 
  4. ^ Kriegs, Jan Ole; Churakov, Gennady; Jurka, Jerzy; Brosius, Jürgen; Schmitz, Jürgen 2007 "Evolutionary history of 7SL RNA-derived SINEs in Supraprimates" Trends in Genetics 23 4: 158–61 doi:101016/jtig200702002 PMID 17307271 
  5. ^ Häsler, Julien; Strub, Katharina 2006 "Alu elements as regulators of gene expression" Nucleic Acids Research 34 19: 5491–7 doi:101093/nar/gkl706 PMC 1636486  PMID 17020921 
  6. ^ Roy-Engel, A M; Carroll, M L; Vogel, E; Garber, R K; Nguyen, S V; Salem, A H; Batzer, M A; Deininger, P L 2001 "Alu insertion polymorphisms for the study of human genomic diversity" Genetics 159 1: 279–90 PMC 1461783  PMID 11560904 
  7. ^ Jurka, J; Smith, T 1988 "A fundamental division in the Alu family of repeated sequences" Proceedings of the National Academy of Sciences 85 13: 4775–8 Bibcode:1988PNAS854775J doi:101073/pnas85134775 PMC 280518  PMID 3387438 
  8. ^ a b Bennett, E A; Keller, H; Mills, R E; Schmidt, S; Moran, J V; Weichenrieder, O; Devine, S E 2008 "Active Alu retrotransposons in the human genome" Genome Research 18 12: 1875–83 doi:101101/gr081737108 PMC 2593586  PMID 18836035 
  9. ^ Richard Shen, M; Batzer, Mark A; Deininger, Prescott L 1991 "Evolution of the master Alu genes" Journal of Molecular Evolution 33 4: 311–20 Bibcode:1991JMolE33311R doi:101007/bf02102862 PMID 1774786 
  10. ^ a b Vansant, G; Reynolds, W F 1995 "The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element" Proceedings of the National Academy of Sciences 92 18: 8229–33 Bibcode:1995PNAS928229V doi:101073/pnas92188229 PMC 41130  PMID 7667273 
  11. ^ Ullu E, Tschudi C 1984 "Alu sequences are processed 7SL RNA genes" Nature 312 5990: 171–2 PMID 6209580 
  12. ^ Britten, R J 1996 "DNA sequence insertion and evolutionary variation in gene regulation" Proceedings of the National Academy of Sciences of the United States of America 93 18: 9374–7 Bibcode:1996PNAS939374B doi:101073/pnas93189374 PMC 38434  PMID 8790336 
  13. ^ Kramerov, D; Vassetzky, N 2005 "Short Retroposons in Eukaryotic Genomes" International Review of Cytology 247: 165–221 doi:101016/S0074-76960547004-7 PMID 16344113 
  14. ^ a b Weichenrieder, Oliver; Wild, Klemens; Strub, Katharina; Cusack, Stephen 2000 "Structure and assembly of the Alu domain of the mammalian signal recognition particle" Nature 408 6809: 167–73 Bibcode:2000Natur408167W doi:101038/35041507 PMID 11089964 
  15. ^ Terreros, Maria C; Alfonso-Sanchez, Miguel A; Novick; Luis; Lacau; Lowery; Regueiro; Herrera September 11, 2009 "Insights on human evolution: an analysis of Alu insertion polymorphisms" Journal of Human Genetics 54: 603–611 doi:101038/jhg200986 
  16. ^ Chimpanzee Sequencing Analysis Consortium 2005 "Initial sequence of the chimpanzee genome and comparison with the human genome" Nature 437 7055: 69–87 Bibcode:2005Natur43769 doi:101038/nature04072 PMID 16136131 
  17. ^ Norris, J; Fan, D; Aleman, C; Marks, J R; Futreal, P A; Wiseman, R W; Iglehart, J D; Deininger, P L; McDonnell, D P 1995 "Identification of a new subclass of Alu DNA repeats that can function as estrogen receptor-dependent transcriptional enhancers" The Journal of Biological Chemistry 270 39: 22777–82 doi:101074/jbc2703922777 PMID 7559405 
  18. ^ Schmid, C W 1998 "Does SINE evolution preclude Alu function" Nucleic Acids Research 26 20: 4541–50 doi:101093/nar/26204541 PMC 147893  PMID 9753719 
  19. ^ Lander, Eric S; Linton, Lauren M; Birren, Bruce; Nusbaum, Chad; Zody, Michael C; Baldwin, Jennifer; Devon, Keri; Dewar, Ken; Doyle, Michael; Fitzhugh, William; Funke, Roel; Gage, Diane; Harris, Katrina; Heaford, Andrew; Howland, John; Kann, Lisa; Lehoczky, Jessica; Levine, Rosie; McEwan, Paul; McKernan, Kevin; Meldrim, James; Mesirov, Jill P; Miranda, Cher; Morris, William; Naylor, Jerome; Raymond, Christina; Rosetti, Mark; Santos, Ralph; Sheridan, Andrew; et al 2001 "Initial sequencing and analysis of the human genome" Nature 409 6822: 860–921 Bibcode:2001Natur409860L doi:101038/35057062 PMID 11237011 
  20. ^ Deininger, Prescott L; Batzer, Mark A 1999 "Alu Repeats and Human Disease" Molecular Genetics and Metabolism 67 3: 183–93 doi:101006/mgme19992864 PMID 10381326 
  21. ^ a b Batzer, Mark A; Deininger, Prescott L 2002 "Alu Repeats and Human Genomic Diversity" Nature Reviews Genetics 3 5: 370–9 doi:101038/nrg798 PMID 11988762 
  22. ^ Shen, S; Lin, L; Cai, J J; Jiang, P; Kenkel, E J; Stroik, M R; Sato, S; Davidson, B L; Xing, Y 2011 "Widespread establishment and regulatory impact of Alu exons in human genes" Proceedings of the National Academy of Sciences 108 7: 2837–42 Bibcode:2011PNAS1082837S doi:101073/pnas1012834108 PMC 3041063  PMID 21282640 
  23. ^ Cordaux, Richard; Batzer, Mark A 2009 "The impact of retrotransposons on human genome evolution" Nature Reviews Genetics 10 10: 691–703 doi:101038/nrg2640 PMC 2884099  PMID 19763152 
  24. ^ Nyström-Lahti, Minna; Kristo, Paula; Nicolaides, Nicholas C; Chang, Sheng-Yung; Aaltonen, Lauri A; Moisio, Anu-Liisa; Järvinen, Heikki J; Mecklin, Jukka-Pekka; Kinzler, Kenneth W; Vogelstein, Bert; de la Chapelle, Albert; Peltomäki, Päivi 1995 "Founding mutations and Alu-mediated recombination in hereditary colon cancer" Nature Medicine 1 11: 1203–6 doi:101038/nm1195-1203 PMID 7584997 
  25. ^ Jin, Lingling; McQuillan, Ian; Li, Longhai 2017 "Computational identification of harmful mutation regions to the activity of transposable elements" BMC Genomics 18 Suppl 9: 862 doi:101186/s12864-017-4227-z PMID 29219079 
  26. ^ Deininger, Prescott 2011 "Alu elements: Know the SINEs" Genome Biology 12 12: 236 doi:101186/gb-2011-12-12-236 PMC 3334610  PMID 22204421 
  27. ^ "SNP in the promoter region of the myeloperoxidase MPO gene" SNPedia [unreliable medical source]
  28. ^ Puthucheary, Zudin; Skipworth, James RA; Rawal, Jai; Loosemore, Mike; Van Someren, Ken; Montgomery, Hugh E 2011 "The ACE Gene and Human Performance" Sports Medicine 41 6: 433–48 doi:102165/11588720-000000000-00000 PMID 21615186 
  29. ^ Dulai, K S; von Dornum, M; Mollon, J D; Hunt, D M 1999 "The evolution of trichromatic color vision by opsin gene duplication in New World and Old World primates" Genome Research 9 7: 629–38 doi:101101/gr97629 PMID 10413401 

External links

  • Alu+Repetitive+Sequences at the US National Library of Medicine Medical Subject Headings MeSH
  • "NCBI Genbank DNA encoding 7SL RNA" 

alu element, alu element chromosome 16, alu element gene, alu element in diagnosis, alu element lncrna, alu element pv92, alu element sequence, alu elements, alu elements genotypes, alu elements in human genome


Alu element Information about

Alu element


  • user icon

    Alu element beatiful post thanks!

    29.10.2014


Alu element
Alu element
Alu element viewing the topic.
Alu element what, Alu element who, Alu element explanation

There are excerpts from wikipedia on this article and video

Random Posts

Amorphous metal

Amorphous metal

An amorphous metal also known as metallic glass or glassy metal is a solid metallic material, usuall...
Arthur Lake (bishop)

Arthur Lake (bishop)

Arthur Lake September 1569 – 4 May 1626 was Bishop of Bath and Wells and a translator of the King Ja...
John Hawkins (author)

John Hawkins (author)

Sir John Hawkins 29 March 1719 – 21 May 1789 was an English author and friend of Dr Samuel Johnson a...
McDonnell Douglas MD-12

McDonnell Douglas MD-12

The McDonnell Douglas MD-12 was an aircraft design study undertaken by the McDonnell Douglas company...